3) The following DNA sequence is the hypothetical coding strand for the botulism toxin protein produced by Clostridium botulinum, the most acutely toxic substance known on earth with a human median lethal dose of ~1/10,000,000 of a gram when injected and about 10 times that amount when inhaled. It derives this lethality by blocking signals between nerves and muscles, sometimes for up to several weeks, also causing paralysis of the muscles that control breathing. However, diluted levels of this toxin can be injected into muscles of the face causing paralysis and reducing wrinkles. Other clinical uses include treating muscle conditions associated with cerebral palsy, multiple sclerosis, stroke and Parkinson's. You want to artificially engineer this protein in the lab for patients (which is much safer than growing C. botulinum), but all you have is the one strand of the DNA sequence for it, shown below. CATCAGGAGGTTTGATCCTATGGCTGGGAATCGGGACTAAAATTCGGGC a. Write out the template strand directly above the coding strand. b. Write out the mRNA sequence below the non-template strand. c. Underline the start and stop codons of the mRNA. d. Indicate the 5' and 3' ends of each DNA strand and the mRNA

3) The following DNA sequence is the hypothetical coding strand for the botulism toxin
protein produced by Clostridium botulinum, the most acutely toxic substance known
on earth with a human median lethal dose of ~1/10,000,000 of a gram when injected
and about 10 times that amount when inhaled. It derives this lethality by blocking
signals between nerves and muscles, sometimes for up to several weeks, also causing
paralysis of the muscles that control breathing. However, diluted levels of this toxin
can be injected into muscles of the face causing paralysis and reducing wrinkles.
Other clinical uses include treating muscle conditions associated with cerebral palsy,
multiple sclerosis, stroke and Parkinson’s. You want to artificially engineer this
protein in the lab for patients (which is much safer than growing C. botulinum), but
all you have is the one strand of the DNA sequence for it, shown below.
CATCAGGAGGTTTGATCCTATGGCTGGGAATCGGGACTAAAATTCGGGC
a. Write out the template strand directly above the coding strand.
b. Write out the mRNA sequence below the non-template strand.
c. Underline the start and stop codons of the mRNA.
d. Indicate the 5′ and 3′ ends of each DNA strand and the mRNA